Review



control odn (no. 1982)  (Coley Pharmaceutical)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Coley Pharmaceutical control odn (no. 1982)
    Control Odn (No. 1982), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/control+odn/us08206725-395-11-18
    Average 90 stars, based on 1 article reviews
    control odn (no. 1982) - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Control:

    Article Title: Vaccination with Novel Immunostimulatory Adjuvants against Blood-Stage Malaria in Mice
    Article Snippet: .. ODN containing CpG motifs (CpG-ODN no. 1826) and control ODN (no. 1982) were a kind gift of Coley Pharmaceuticals Canada (Ottawa, Ontario, Canada). ..



    Similar Products

    control odn 1982  (Microsynth ag)
    90
    Microsynth ag control odn 1982
    Control Odn 1982, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/control+odn+1982/pmc05373453-300-13-16
    Average 90 stars, based on 1 article reviews
    control odn 1982 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    control odn (no. 1982)  (Coley Pharmaceutical)
    90
    Coley Pharmaceutical control odn (no. 1982)
    Control Odn (No. 1982), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/control+odn/us08206725-395-11-18
    Average 90 stars, based on 1 article reviews
    control odn (no. 1982) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    control 1982 odn  (Enzo Biochem)
    90
    Enzo Biochem control 1982 odn
    Control 1982 Odn, supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/control+1982+odn/pmc02597678-37-11-14
    Average 90 stars, based on 1 article reviews
    control 1982 odn - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    phosphorothioate-linked non-cpg control odn 1982  (Coley Pharmaceutical)
    90
    Coley Pharmaceutical phosphorothioate-linked non-cpg control odn 1982
    Phosphorothioate Linked Non Cpg Control Odn 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/phosphorothioate+linked+non+cpg+control+odn+1982/pmc01976275-44-19-31
    Average 90 stars, based on 1 article reviews
    phosphorothioate-linked non-cpg control odn 1982 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    control odn 1982  (Coley Pharmaceutical)
    90
    Coley Pharmaceutical control odn 1982
    Control Odn 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/control+odn/pm18072859-38-6-12
    Average 90 stars, based on 1 article reviews
    control odn 1982 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    negative control 1982 odn devoid of cpg motifs  (Coley Pharmaceutical)
    90
    Coley Pharmaceutical negative control 1982 odn devoid of cpg motifs
    Negative Control 1982 Odn Devoid Of Cpg Motifs, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/negative+control+1982+odn+devoid+of+cpg+motifs/pm17982080-76-10-19
    Average 90 stars, based on 1 article reviews
    negative control 1982 odn devoid of cpg motifs - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    control odn 1982  (Generi Biotech)
    90
    Generi Biotech control odn 1982
    Control Odn 1982, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/control+odn+1982/pm16217768-48-4-19
    Average 90 stars, based on 1 article reviews
    control odn 1982 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    control odn sequence 1982  (Coley Pharmaceutical)
    90
    Coley Pharmaceutical control odn sequence 1982
    Control Odn Sequence 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/control+odn/pmc01064943-53-27-38
    Average 90 stars, based on 1 article reviews
    control odn sequence 1982 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    control odn sequence 1982 (tccaggacttctctcaggtt)  (Coley Pharmaceutical)
    90
    Coley Pharmaceutical control odn sequence 1982 (tccaggacttctctcaggtt)
    Control Odn Sequence 1982 (Tccaggacttctctcaggtt), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+odn+(no%2E+1982)/control+odn/pmc01064943-141-27-38
    Average 90 stars, based on 1 article reviews
    control odn sequence 1982 (tccaggacttctctcaggtt) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results